Home Archives Random Quotes Latest Comments Top 100 Submit Quote Search Log In Forums
1 2 3 4 5
Quote# 76068

(Ironically, the article was from LiveScience entitled 'Clues to Obama's Muslim Problem', regarding the psychological effects of priming in developing an irrational belief.)


True Clues to Obama's Muslim Problem"

1. The "my muslim faith" interview slip up with Snufflelufogus, and quick correction by Snuffles. When have you as a Christian ever make such a mistake?

2. Calling the Koran, the "Holy Koran". What Christian ever refers to another religions' book as "Holy"? We only call one book Holy, the Holy Bible. When we refer to other religious books we just call them their name.

3. The muslim call to prayer being one of the prettiest sounds on earth. Do you as a Christian believe that?

4. Three times a day Obama goes into a separate room in the White House without anyone else for a short period of time. Muslims outside of islamic lands can instead of havign to pray five times a day, can if they are outside islamic lands instead pray three times a day. And yes Michelle goes into a separate room and does the same thing.

5. Bowing to the Saudi King as a subject under Islam.

6. Regular interviews with old school buddies explaining how Obama was a devout muslim, discussing how he would pray in their families' prayer rooms in Indonesia (the largest muslim country on earth).

7. Being registered at the St Francis Assisi school in Indonesia as a muslim. Parents could choose to register kids either as Christians or Muslims.

8. Remember the first dog being flown on a separate jet? What do muslims think of dogs? Perhaps we can see why it took over 6 months for him to even pick one?

9. What Obama is doing to the US Bank system. Punishment for not having sharia law lending practices, collecting interest, etc.

10. First thing in office, dropping every govt agency from using 'islamic fanatics' from their vocabularies.

11. Most of his family is muslim. Discussed in his book about that, discussed how proud he was of his brother converting to islam.

12. The Egyptian Foreign Minister, Adul Gheit said he had a one-on-one meeting with Obama, where the US President told him that He was still a Muslim


"Kate", Yahoo News 42 Comments [9/16/2010 3:53:36 AM]
Fundie Index: 63
Submitted By: Ludd
WTF?! || meh

Quote# 76064

(“....Yet he says he’s a “well-adjusted heterosexual” whose upbringing [being raised by gay parents] proves that love, not gender, makes a family.”)

Bullshit! He’s Leftist feminized, doesn’t know it, weak of character (NO, being feminized doesn’t constitute “weak of character, what constitutes “weak of character” in this particular application is the lifelong indoctrination to Leftist feminism, which is the course the gay “Parents” set off with in the first place. To promote their own agenda.

These sorts need not be given any credence whatsoever. They are unfortunate and brainwashed freaks.

rockinqsranch, FreeRepublic 50 Comments [9/16/2010 3:52:53 AM]
Fundie Index: 58
Submitted By: Son Goku On The Flying Nimbus
WTF?! || meh

Quote# 76062

English Catholics have withstood the massacres of Henry V111, Elizabeth 1 and Cromwell’s Jewish sponsored genocide. Like the Palestinians we were here first and we are not going away.
So all you Jews and your Protestant lackeys can hit the bricks.

By the way, the evil crimes of some Catholic priests is nothing compared to the huge number of paedophile rabbis, organ trafficking rabbis, money laundering rabbis etc etc. but we’ll never read this truth in the Jewish controlled British media.
Now watch this comment disappear.

giuseppesapone, The Independent 89 Comments [9/15/2010 10:20:18 AM]
Fundie Index: 68
WTF?! || meh

Quote# 76051

Modern so-called scientists believe in Evolution not that Allah created the universe , so they cann't accept the Geocentric fact!.. Why? .. because if the stars and all the planets orbit Earth and Earth is the center of the universe so the whole universe was created for the intelligent creature that lives on Earth .. Man. They refuse to accept that , they say Earth is a minor planet in the corner of the universe .. a not-that-important planet. and that belief leads to the idea of life on other planets of course! .. They say that as life developed on the planet earth then it may - and very possibly - have developed on one of the other billions. So the idea of geocentric universe gives too much importance to Earth and Man .. and NASA does not want that.

They believe in Evolution : a substitute for Creation and a creator god.
They believe in Planetary Gravity : a substitute for Allah as He holds the Sun and planets not letting them fall on us.
They believe in Heliocentricity : a substitute for an Earth in the Center of the world.
They believe in ExtraTerrestrials (ETs) : a substitute for Man as the center of the universe.

Mando Salama, Geocentric Islam 77 Comments [9/14/2010 4:04:29 PM]
Fundie Index: 116
Submitted By: DevilsChaplain
WTF?! || meh

Best Plague Ever

Your choices for the end of the world are locusts or lesbians, which do you choose?

Quote# 76041

I want to talk as a mother to the young women today. We know that it's not just the men who have a problem with pornography and I want to say it like this: girl-on-girl kissing, lesbianism is a plague on our society today.

And I want to read the word of God and I want us to pray. Roman 1: 25 says those who exchanged the truth of God for a lie, and worshiped and served the creature rather than the Creator blessed forevermore, for this reason God game them up to vile passions where even their women exchanged the natural use for what is against nature.

I'm going to call on the women and I want to say that it's time for us to repent.

This girl-on-girl kissing, Madonna kissing Britney Spears, and what happened to Britney after that and a lot of other things. I know we're going out over worldwide television. I want to tell you, bisexuality, every kind of perverse thing, the Bible calls this sin. And I want the women of God to kneel down right now and we are going to put a stop to this in our generation and we are going to say "No More!"

And I want to say to you, this gender mainstreaming that says that you don't know if you're a boy or a girl until you have sex with both, boy or girl, has got to stop. If we agree right now that there is a holyness movement coming, we decree in the name of Jesus that men and women are going to be their natural use, in the name of Jesus.

One of you young women want to repent for that, lesbianism?

Cindy Jacobs, Right Wing Watch 87 Comments [9/14/2010 11:40:16 AM]
Fundie Index: 75
Submitted By: DevilsChaplain
WTF?! || meh

Quote# 76040

Flatland: Here's an example of a genetic sequence:
acaagatgccattgtcccccggcctcctgc

Please give us an example of what "new code" would look like.

------------------

Heaven-Sent: how about adding any letter besides a, c, g, or t.

Heaven-Sent, ChristianForums 75 Comments [9/14/2010 10:00:29 AM]
Fundie Index: 125
WTF?! || meh

Quote# 76032

[Re. the "Ground Zero Mosque"]

Lets keep America, America!

Agree!

Obama? Obama and Company? Should be tried for treason in this issue for promoting the establishment of a foreign government on our soils. As a Muslim, he knows this, he knows sharia, but is looking to deceive America.

Give him the punishment for TREASON.

The first amendment was for religion not the Islamics government in tow called sharia. The founding fathers sought to protect the sovereignty of their baby and would never allow a foreign governmental influence compete with their baby!

Our founding fathers would be horrified at the condition of this country.

nmh, Free Republic 78 Comments [9/14/2010 12:28:17 AM]
Fundie Index: 71
Submitted By: DevilsChaplain
WTF?! || meh

Quote# 76029

[The U.S. military confiscated and burned unsolicited Bibles which were sent by a church and printed in the two most common Afghan languages for fear that they would be used in an attempt to convert Afghans to Christianity.]

I either forgot about this or don't remember it, but either way, it was an abomination and the poster child of Political Correctness/Nation Building/Multiculturalism, run amok.

What is worse is that according to the timeline (supposedly May 2008) this would have made it under W's watch, which should not surprise anyone, as this poor naive, uninformed and misled (no doubt by Islamo-Fascist, Jihad/Muslim Brotherhood-supporting TRAITOR--Grover Norquist--who should have been banned and shunned by all Conservatives a long time ago) "Compassionate Conservative" RINO, Bush, started out being a "Crusader-like Commander,"--ready, willing and able to kick some Radical-Islamic ass--and ended up like so many other "Dhimmis" praising/defending/appeasing, the faux, cult-cum-religion of "Pieces!" and its practitioners!

GOD forbid (pun intended) we should have allowed any "Proseletizing" and anyone trying to convert the heathen/barbarian/rock-worshipping-pagans.

Conservative Vermont Vet, Free Republic 50 Comments [9/14/2010 12:27:47 AM]
Fundie Index: 54
Submitted By: DevilsChaplain
WTF?! || meh

Quote# 76028

Funny how the left is all about protecting religious freedom when it comes to building the mosque, but totally against the freedom to burn korans. I want muslims to know their satanic cult isn’t wanted here. America needs to get their collective heads out of the sand and see what islam has done to other countries and what it will inevitably do in America. Islam is in no way compatible with American laws and ideals, in spite of what muzzie Barry says.

ilovesarah2012, Free Republic 61 Comments [9/13/2010 9:15:19 PM]
Fundie Index: 59
Submitted By: DevilsChaplain
WTF?! || meh

Quote# 76004

People hate Christians. The mood of today is to do anything you want. "Self." They hate anyone who tells them no. It is a generation of spoiled children who want only to amuse themselves, and they don't want anyone stopping them. They scream "Toleration," yet they cannot tolerate Christianity which refuses to give them the green light on all manner of sin.

During the Tribulation, throngs of people will cheer loudly when Christians are tortured, burned, beheaded, thrown to lions, and more. "How's it feel," the crowds will yell, celebrating with evil deeds.

Those who are left behind after the Rapture are going to be hunted like dogs and cut down in the streets and paraded like slaves down streets, where they are murdered in front of cheering crowds.

Or you can accept Jesus and admit you are a sinner, and ask him to forgive you.

Micheal Mullen, WOTA 92 Comments [9/13/2010 8:18:00 PM]
Fundie Index: 85
WTF?! || meh

Quote# 76031

There is only one answer to islam and Ann Coulter hit it on the head. Conquer their countries, kill their leaders, and convert them to Christianity.

Way back when it was said that the arab is either at your throat or at your feet. This applies more generally to the moslem. We have allowed them to be at our throats for far too long. We need to put them back at our feet until we can eradicate them entirely.

I fully support nuking mecca and medina and every moslem city of over 50,000. I figure that would be a good start. If they want to behave like stone age barbarians then lets really put them back in the stone age.

John O, Free Republic 86 Comments [9/13/2010 10:55:57 AM]
Fundie Index: 112
Submitted By: DevilsChaplain
WTF?! || meh

Quote# 76030

Gay men account for over 80% of all new AIDS cases every year in AUSTRALIA, this stat never changes. LEGALIZE GAY MARRIAGE, and you may as well LEGALIZE MURDER (so much for LOVE). It's never going to be curable, unless the Climate Change Wizards get onto this one as well. It's totally irresponsible and is as old as L...OT -(gr8 man)-. DON'T LEGALIZE AIDS PROCUREMENT and the things that kill life. Instead create LIFE by not turning Marriage into a total LIE!!! GO MAN and GO WOMAN! IT ACTUALLY WORKZ!!! BLESS! PEACE! OUT.

Mark Mcfarlane, Facebook-Protect Marriage:One Man, One Woman 65 Comments [9/13/2010 6:26:10 AM]
Fundie Index: 82
Submitted By: Ian
WTF?! || meh

Quote# 76024

The Bible actually says [homosexuality] is a mental disorder as well.

In Romans it says because they did not WISH to RETAIN knowledge of God, He gave them over...

He does not give up on Murderers, Adulterers, Thieves, Liars. He does give up on the Sodomites.

Why? Because they are not reprogrammable after a certain point. They go down a dark road into mental defect from which there is no return.

This is why so FEW do repent and recover. Oh, some do, Praise Be. But most do not, will not, cannot.

RachelFaith, Free Republic 57 Comments [9/13/2010 3:48:27 AM]
Fundie Index: 84
Submitted By: DevilsChaplain
WTF?! || meh

Quote# 76023

A final reason for opposition to homosexuality is the homosexual "lifestyle." While it is possible for male homosexuals to live lives of fidelity comparable to those of heterosexual males, it is usually not the case. While the typical lesbian has had fewer than ten "lovers," the typical male homosexual in America has had over 500. In general, neither homosexuals nor heterosexuals confront the fact that it is this male homosexual lifestyle, more than the specific homosexual act, that disturbs most people. This is probably why less attention is paid to female homosexuality. When male sexuality is not controlled, the consequences are considerably more destructive than when female sexuality is not controlled. Men rape. Women do not. Men, not women, engage in fetishes. Men are more frequently consumed by their sex drive, and wander from sex partner to sex partner. Men, not women, are sexually sadistic. The indiscriminate sex that characterizes much of male homosexual life represents the antithesis of Judaism's goal of elevating human life from the animal-like to the Godlike.

Dennis Prager, OrthodoxyToday.org 78 Comments [9/13/2010 3:48:08 AM]
Fundie Index: 72
Submitted By: DevilsChaplain
WTF?! || meh

Quote# 76022

The bedrock of this civilization, and of Jewish life, has been the centrality and purity of family life. But the family is not a natural unit so much as it is a value that must be cultivated and protected. The Greeks assaulted the family in the name of beauty and Eros. The Marxists assaulted the family in the name of progress. And today, gay liberation assaults it in the name of compassion and equality. I understand why gays would do this. Life has been miserable for many of them. What I have not understood was why Jews or Christians would join the assault. I do now. They do not know what is at stake. At stake is our civilization.

It is very easy to forget what Judaism has wrought and what Christians have created in the West. But those who loathe this civilization never forget. The radical Stanford University faculty and students who recently chanted, "Hey, hey, ho, ho, Western civ has got to go," were referring to much more than their university's syllabus. And no one is chanting that song more forcefully than those who believe and advocate that sexual behavior doesn't play a role in building or eroding civilization. The acceptance of homosexuality as the equal of heterosexual marital love signifies the decline of Western civilization as surely as the rejection of homosexuality and other nonmarital sex made the creation of this civilization possible.

Dennis Prager, OrthodoxyToday.org 43 Comments [9/13/2010 3:48:01 AM]
Fundie Index: 47
Submitted By: DevilsChaplain
WTF?! || meh

Quote# 76008

I look at everything from a Biblical standpoint, so to me the only way to have a successful government is to let God control it. That is how this country was founded and I believe why it was the greatest nation in the world.

Moses and Aaron were the first judges. God told them how to set up the justice system and He made all of the rules. It was about justice and fairness for all. God was always been in charge of the government and He still could be if we let him.

It's not about religion, it's about obeying our creator. If we go against Him, we don't stand a chance.

Jodie, Moonbattery 51 Comments [9/13/2010 3:45:55 AM]
Fundie Index: 61
Submitted By: DevilsChaplain
WTF?! || meh

Quote# 76009

It really is pretty simple, but some people are not ready to accept it. Liberals are those people who are rebelling against God, i.e., pro-abortion, pro-homosexuality, pro-Muslim, anti-Christian and anti-Jew.

Conservatives are those who are written in God's Book of Life. They might not all be believers yet, but most likely they will be some day.

I know I will get flack for this, but I pray before I write every comment and I always try to say what I feel that God is telling me to say.

Jodie, Moonbattery 47 Comments [9/13/2010 1:57:45 AM]
Fundie Index: 83
Submitted By: DevilsChaplain
WTF?! || meh

Quote# 75999

[In response to: American Muslims Ask, Will We Ever Belong?]

If they want to blend in and not impose their religion on everybody else, then yes, maybe they can belong. But Muslims are not willing to do that.

dfwgator, Free Republic 50 Comments [9/12/2010 6:09:22 PM]
Fundie Index: 36
Submitted By: gaijinlaw
WTF?! || meh

Quote# 75987

Why do atheists make things up in regards to evolution?

I was just told that certain animals have not evolved for over millions of years because 40 million year old fossils were found that are exactly the same as the animals that exist today, example lions and tigers fossils were found and dated at 40 million years..

If evolution exists then how on earth can animals such as lions and tigers avoid evolving for 40 million years, first you guys say that evolution is on going then you say it stands still, what next "it doesn't exist?", make your minds up, you evolution believers will have an answer im sure but it will be a pathetic one

Frizby, Yahoo Answers 45 Comments [9/12/2010 6:08:37 PM]
Fundie Index: 58
Submitted By: rawrdino
WTF?! || meh

Quote# 75996

[not that i aprove of gay marriages btw just think there are bigger issues that we, as christians should be concerned with]

Having "bigger" issues on our plate is just the distraction Satan would love.

Shannon Williams, NOM facebook page 55 Comments [9/12/2010 7:14:59 AM]
Fundie Index: 56
Submitted By: Corbin
WTF?! || meh

Quote# 75995

Abortion is a lot more evil than fratricide.

FAzRiN, Top 10 Fratricidal Baby Animals 46 Comments [9/12/2010 7:13:40 AM]
Fundie Index: 68
WTF?! || meh

Quote# 75985

did u ever read the Quran well ? it really has scientific proves that link the Creator and his creations...

Since some weeks ago, at least three new findings refuting the evolution. how did u know there is a prove ? gosh. did einstein believe in evolution ? lol did darwin knew abt relativity or DNA...
keep believing that ur monkey, it is becomes more stupid lol

evolution is collapsed so why naive nasty people keep believing in it ?

mr. lardjane, Y! answers 73 Comments [9/11/2010 12:20:40 PM]
Fundie Index: 93
WTF?! || meh

Quote# 75969

In Hebrews 13, God says:

7Remember your leaders, who spoke the word of God to you. Consider the outcome of their way of life and imitate their faith.

17Obey your leaders and submit to their authority.

These are the kinds of leaders I believe that God is referring to:

Sheriff Joe Arpaio
Jan Brewer
Rush Limbaugh
Sean Hannity
Michael Savage
Newt Gingrich
George Bush
Sarah Palin
Michele Bachmann
Liz Cheney
Hal Lindsey
Jack and Rexella Van Impe

Jodie, Moonbattery 76 Comments [9/11/2010 5:11:07 AM]
Fundie Index: 94
Submitted By: DevilsChaplain
WTF?! || meh

Quote# 75971

They distort, rape, and scandolize the concept of biblical love. I find that repulsive. I actually had a homosexual women support her lifestyle choice by using the scripture that says "love your neighbor as yourself". LOL Her mental capacity was exposed at that point.

Shannon Williams, Facebook 53 Comments [9/10/2010 9:08:19 PM]
Fundie Index: 76
WTF?! || meh

Quote# 75968

We need to bring down the ACLU they are distroying our Nation. It's time a President shut them down. There should be no such group anyway. If a person feels wrongly accused then hire an individual attorney to handle their case. Who are these creeps anyway and how did their Moral compass get so twisted the wrong way. The Bible says in end times people will believe what is right is wrong and what is wrong is right. We know where ACLU stands.

Anonymous Commenter, OneNewsNow 52 Comments [9/10/2010 9:08:00 PM]
Fundie Index: 54
WTF?! || meh
1 2 3 4 5